The sirtuin family of proteins have a diverse range of biological functions accomplished by the deacetylation of their targets. Derived from H1299 cells; this Sirt7 knockdown cell line was displays lentiviral-driven stable expression shRNA scramble sequences and a Sirt7 specific shRNA. These cells would be suitable for use in the study of the functions of Sirt7 and the sirtuin family of proteins
Cell Type
Drug Discovery Cell Lines
Disclaimer
1. For for-profit organizations and corporations, please contact [email protected] for pricing of this item. 2. Sale of this item is subjected to the completion of a Material Transfer Agreement (MTA) by the purchasing individual/institution for each order. If you have any questions regarding this, please contact us at [email protected]. 3. All test parameters provided in the CoA are conducted using abm's standardized culture system and procedures. The stated values may vary under the end-user's culture conditions. Please verify that the product is suitable for your studies by referencing published papers or ordering RNA (0.5 mug, Cat.# C207, $450.00) or cell lysate (100 mug, Cat.# C206, $600.00) to perform preliminary experiments, or alternatively use our Gene Expression Assay Service (Cat# C138). All sales are final. 4. We recommend live cell shipments for ease of cell transfer and this option can be requested at the time of ordering. Please note that the end-user will need to evaluate the feasibility of live cell shipment by taking into account the final destination's temperature variation and its geographical location. In addition, we thoroughly test our cell lines for freeze-thaw recovery. If frozen cells were received and not recovered in your lab under the exact, specified conditions (using recommended culture vessel, media, additional supplements, and atmospheric conditions), a live cell replacement is possible at a cost (plus shipping). 5. All of abm's cell biology products are for research use ONLY and NOT for therapeutic/diagnostic applications. abm is not liable for any repercussions arising from the use of its cell biology product(s) in therapeutic/diagnostic application(s). Please contact a technical service representative for more information. 6. abm makes no warranties or representations as to the accuracy of the information on this site. Citations from literature and provided for informational purposes only. abm does not warrant that such information has been shown to be accurate. 7. abm warrants that cell lines shall be viable upon initiation of culture for a period of thirty (30) days after shipment and that they shall meet the specifications on the applicable abm Material Product Information sheet, certificate of analysis, and/or catalog description. Such thirty (30) day period is referred to herein as the "Warranty Period."
Expression Level
Puromycin resistance at the concentration of 5 ug/mL. The cells stably express the short hairpin RNA (shRNA) scramble sequence: 5'-CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTT AGG-3' and the Sirt7 specific shRNA 5'- CCGGGTCCAGCCTGAAGGTTCTAAACTCGAGTTTAGAACCTTCAGGCTGGACTTTTTG-3'.
Quantity
1x106 cells / 1.0 ml
Tissue
Lung
Morphology
Epithelial-like
Population Doubling
43 - 53 hours
Species
Human (H. sapiens)
Quality Control
1) Immunofluorescence; 2) DNA analysis and qPCR; 3) AgNOR staining